Stem-loop sequence mtr-MIR2111e

AccessionMI0011839 (change log)
DescriptionMedicago truncatula miR2111e stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111e
(8 sentences)

Stem-loop
   a      -   -uc  uu        u      ug         acaac   ugc 
5'  uauugg gau   ga  ggauaauc gcaucc  agguuuaga     aga   g
    |||||| |||   ||  |||||||| ||||||  |||||||||     |||    
3'  guaacc cua   cu  ucuauuag cguagg  uccgaaucu     ucu   u
   c      a   uuc  uc        u      gu         ----a   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16678770-16678875 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111e
mtr-MIR2111cchr7: 16686087-16686193 [-]
mtr-MIR2111dchr7: 16685914-16686016 [-]
mtr-MIR2111echr7: 16678770-16678875 [-]
mtr-MIR2111fchr7: 16671474-16671589 [-]
Database links

Mature sequence mtr-miR2111e-5p

Accession MIMAT0013292
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence mtr-miR2111e-3p

Accession MIMAT0026927
Sequence

67 - 

agccuugggaugcugauuauc

 - 87

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).