Dead miRNA entry

miRNA accession:
MI0011840
miRNA ID:
mtr-MIR2111l
Forward to:
MI0011839
Comment:
The MIR2111 loci in miRBase 19 overlap in the Mt3.5.2 genome assembly. The entries are rationalised and merged in miRBase 20, leading to several entries being renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR2111l

AccessionMI0011840 (change log)
DescriptionMedicago truncatula miR2111l stem-loop
Stem-loop
   aacaacagaugcguaauucuauc       ug      u        cu       ca      caaaacuaugaaaucaauuugauauaguuuccauuuu 
5'                        uaagccu  ggaugc gauuaucu  uccuuau  ccaaug                                     a
                          |||||||  |||||| ||||||||  |||||||  ||||||                                     c
3'                        auuugga  ccuacg cuaauaga  aggaaug  gguuau                                     a
   ----cuguugauguuauaacgaa       gu      u        uu       --      aaagaugguuaagauaguacugcuguauaacgagauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16644069-16644155 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111l
mtr-MIR2111ichr7: 16649857-16649962 [-]
mtr-MIR2111jchr7: 16649192-16649293 [-]
mtr-MIR2111kchr7: 16644233-16644366 [-]
mtr-MIR2111lchr7: 16644069-16644155 [-]
mtr-MIR2111mchr7: 16637685-16637791 [-]
mtr-MIR2111nchr7: 16637529-16637662 [-]
Database links

Mature sequence mtr-miR2111l

Accession MIMAT0013293
Sequence

160 - 

auaaucugcauccugagguuu

 - 180

Get sequence
Evidence experimental;