Stem-loop sequence mtr-MIR2111g

AccessionMI0011841 (change log)
DescriptionMedicago truncatula miR2111g stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111g
(8 sentences)

Stem-loop
   a      -gug    ug            uc          a  c   au           ccaaa 
5'  uauugg    agga  ggauaaucugca  cugagguuua ga aau  uugcguaauuu     a
    ||||||    ||||  ||||||||||||  |||||||||| || |||  |||||||||||     a
3'  guaacc    uccu  ucuauuaggcgu  ggcuccgaau cu uug  aaugcguuaaa     a
   c      acua    uu            ga          -  -   cu           uaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2111g-5p

Accession MIMAT0013294
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1]

Mature sequence mtr-miR2111g-3p

Accession MIMAT0013288
Sequence

94 - 

agccucggagugcggauuauc

 - 114

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).