Stem-loop sequence mtr-MIR2111h

AccessionMI0011842 (change log)
DescriptionMedicago truncatula miR2111h stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111h
(8 sentences)

Stem-loop
   -au      --       uua      c     c ug   u   -u      au 
5'    uauugg  guaagga   gauaau ugcau c  agg uua  agcaau  u
      ||||||  |||||||   |||||| ||||| |  ||| |||  ||||||   
3'    guaacc  uauuccu   cuauua acgua g  ucc aau  uuguug  g
   aac      gu       uuc      a     a gu   u   uu      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16655725-16655830 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111h
mtr-MIR2111gchr7: 16661325-16661456 [-]
mtr-MIR2111hchr7: 16655725-16655830 [-]
mtr-MIR2111ichr7: 16649857-16649962 [-]
mtr-MIR2111jchr7: 16649192-16649293 [-]
Database links

Mature sequence mtr-miR2111h

Accession MIMAT0013295
Sequence

21 - 

uaaucugcauccugagguuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).