Stem-loop sequence mtr-MIR2111i

AccessionMI0011843 (change log)
DescriptionMedicago truncatula miR2111i stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111i
(8 sentences)

Stem-loop
   a     -a   -u   ua            uc ug         aua    cug 
5'  uauug  guu  gga  ggauaaucugca  c  agguuuaga   acag   c
    |||||  |||  |||  ||||||||||||  |  |||||||||   ||||    
3'  guaac  caa  ccu  ucuauuagacgu  g  uccgaaucu   uguu   g
   g     ca   uu   uc            ga gu         --a    aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2111i

Accession MIMAT0013296
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).