Stem-loop sequence mtr-MIR2111n

AccessionMI0011846 (change log)
DescriptionMedicago truncatula miR2111n stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111n
(8 sentences)

Stem-loop
   uauau       ---   ug            uc ug       -    aaua    c       ccccu 
5'      uggguga   gga  ggauaaucugca  c  agguuua aaac    guua guaauua     a
        |||||||   |||  ||||||||||||  |  ||||||| ||||    |||| |||||||     a
3'      auccacu   ccu  ucuauuagacgu  g  uccgaau uuug    uaau cauugau     a
   --cgu       auu   uu            ga gu       c    ---c    a       uaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16637529-16637662 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111n
mtr-MIR2111kchr7: 16644233-16644366 [-]
mtr-MIR2111lchr7: 16644069-16644155 [-]
mtr-MIR2111mchr7: 16637685-16637791 [-]
mtr-MIR2111nchr7: 16637529-16637662 [-]
Database links

Mature sequence mtr-miR2111n

Accession MIMAT0013299
Sequence

21 - 

uaaucugcauccugagguuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).