Stem-loop sequence mtr-MIR2111o

AccessionMI0011847 (change log)
DescriptionMedicago truncatula miR2111o stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111o
(8 sentences)

Stem-loop
   --ag         --    ucc       u           u   -aa      a 
5'     uauugguua  agga   gguaauc gcauccugagg uua   acaaua a
       |||||||||  ||||   ||||||| ||||||||||| |||   ||||||  
3'     guaaccagu  uccu   ccauuag cguagggcucc gau   uguuau u
   acau         au    uuu       u           u   cua      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16621471-16621577 [-]
intergenic
Database links

Mature sequence mtr-miR2111o

Accession MIMAT0013300
Sequence

21 - 

uaaucugcauccugagguuua

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).