Stem-loop sequence mtr-MIR2598

AccessionMI0011848 (change log)
DescriptionMedicago truncatula miR2598 stem-loop
Gene family MIPF0000834; MIR2590
Stem-loop
   -                                                              u               a                 au       caaguguuuuuuuuuuuuuugacaaauuuaucaacaaguauuuuagaaagaaaaaaagaacau 
5'  ggacuauuucuugauaaaaucuaagggugauuauucugccaugucauucuugaaauuuuuuu gaaaaaaucuuucuu auauauagcauugcucu  uuauuaa                                                               u
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||  |||||||                                                                
3'  ccugauaaagaacuauuuuagauucccacuaauaagacgguacaguaagaacuuuaaaaaaa cuuuuuuagaaagaa uauauaucguaacgaga  aauaauu                                                               u
   u                                                              -               c                 --       aauagcgauaagauucuauaaaucaguugcaaaauuuuucagauuuuauuuuuuaaguuaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 37313308-37313643 [+]
intergenic
Database links

Mature sequence mtr-miR2598

Accession MIMAT0013301
Sequence

21 - 

cuaagggugauuauucugcca

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).