Stem-loop sequence mtr-MIR2599

AccessionMI0011849 (change log)
DescriptionMedicago truncatula miR2599 stem-loop
Gene family MIPF0000913; MIR2599
Stem-loop
   -       a       a   a                     a    a     u    -----------       cg      u  a  u 
5'  uaaacaa gaauaaa cau uggguacaaggaaucuacuuu uuca cacac aacc           uaauuuc  agacau uu ca g
    ||||||| ||||||| ||| ||||||||||||||||||||| |||| ||||| ||||           |||||||  |||||| || ||  
3'  auuuguu cuuauuu gua acccauguuccuuagaugaaa aagu gugug uugg           auuaaag  ucugua aa gu c
   u       c       a   c                     c    c     u    uucuuuuuggu       au      c  a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 12574785-12574956 [-]
intergenic
Database links

Mature sequence mtr-miR2599

Accession MIMAT0013302
Sequence

21 - 

uggguacaaggaaucuacuuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).