Stem-loop sequence mtr-MIR2600a

AccessionMI0011850 (change log)
Previous IDsmtr-MIR2600
DescriptionMedicago truncatula miR2600 stem-loop
Gene family MIPF0001284; MIR2600
Stem-loop
   c      accuuu            a                     c     aaaga 
5'  ggguac      uugggugacauu gccaaucacaaugccacaaug uugug     g
    ||||||      |||||||||||| ||||||||||||||||||||| |||||     a
3'  cuuaug      gacccacuguaa cgguuaguguuacgguguuac aacac     g
   u      ------            c                     a     aaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 6096933-6097045 [+]
intergenic
Database links

Mature sequence mtr-miR2600a

Accession MIMAT0013303
Previous IDsmtr-miR2600
Sequence

21 - 

acauuagccaaucacaaugcc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).