Stem-loop sequence mtr-MIR2601

AccessionMI0011851 (change log)
DescriptionMedicago truncatula miR2601 stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   a          u                                  cuaaaaaaaagauuguuugaguacuuuaauuuaauuuucguuacauuuuuugguccauucc 
5'  uuuugguccu uaaguauuuauuugguaucgcuuuggucccuuaa                                                             g
    |||||||||| ||||||||||||||||||||||||||||||||||                                                             u
3'  aaaaccaggg auucauaaauaaaccauagugaaaccagggaauu                                                             u
   g          c                                  acaaaggucucgguuacgguuuugcugugcacauagugugaauuguaaaaaauaauuugga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 45064513-45064729 [+]
intergenic
Database links

Mature sequence mtr-miR2601

Accession MIMAT0013304
Sequence

21 - 

uauuugguaucgcuuugguccc

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).