Stem-loop sequence mtr-MIR2602a

AccessionMI0011852 (change log)
DescriptionMedicago truncatula miR2602a stem-loop
Gene family MIPF0000820; MIR2585
Stem-loop
   a    caca         c                  a   c           c     a      aagaagaggacaaaauau 
5'  cugc    ucacuaauu gaugacguggcaaucacu cca acaugaaauuc aauuu gcccuu                  u
    ||||    ||||||||| |||||||||||||||||| ||| ||||||||||| ||||| ||||||                  g
3'  gacg    agugauuaa cuacugcaccguuaguga ggu uguacuuuaag uuaaa ugggga                  a
   -    auac         a                  c   a           a     a      cccaaagguuaagaaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 13768425-13768594 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2602a
mtr-MIR2602achr5: 13768425-13768594 [+]
mtr-MIR5291bchr5: 13770442-13770509 [-]
Database links

Mature sequence mtr-miR2602a

Accession MIMAT0013305
Sequence

131 - 

uggcagugauugccacgucau

 - 151

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).