Stem-loop sequence mtr-MIR2602b

AccessionMI0011853 (change log)
DescriptionMedicago truncatula miR2602b stem-loop
Gene family MIPF0000820; MIR2585
Stem-loop
   a   c  c          c                  a   c                        aagaa   --ga   aua  g 
5'  cug ca gucacuaauu gaugacguggcaaucacu cca acaugaaauuccaauuuugcccuu     gag    caa   uu a
    ||| || |||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||     |||    |||   || a
3'  gac gu cagugauuaa cuacugcaccguuaguga ggu uguacuuuaagguuaaaaugggga     cuc    guu   aa g
   -   c  a          a                  c   a                        -----   aaag   aag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 38414668-38414836 [-]
intergenic
Database links

Mature sequence mtr-miR2602b

Accession MIMAT0013306
Sequence

130 - 

uggcagugauugccacgucau

 - 150

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).