Stem-loop sequence mtr-MIR2603

AccessionMI0011854 (change log)
DescriptionMedicago truncatula miR2603 stem-loop
Stem-loop
   -                  --       u        c                                               u           a      caac  -ag  c     aaucauuucacgcccacguggcaccaauaucaauauuuu 
5'  uuggucccugcacuuuuu  uguuugg auuggucc ugcacuuuguaaaaauauugguauugguuccucuguuaacuuucugu aaaaaaaaaac caaaac    gg   ug ggccc                                       u
    ||||||||||||||||||  ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||    ||   || |||||                                        
3'  aaccagggaugugaaaaa  acaaacc uaaccagg acgugaaacauuuuuauaaccauaaccagggagauaauugaaagaca uuuuuuuuuug guuuug    cc   ac ccggg                                       a
   u                  aa       u        a                                               -           g      auaa  aua  -     acgugaaacauuuuauaaccauaaacagggacguuaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 38174285-38174600 [+]
intergenic
Database links

Mature sequence mtr-miR2603

Accession MIMAT0013307
Sequence

21 - 

uuugguauuggucccugcacuu

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).