Stem-loop sequence mtr-MIR2604

AccessionMI0011855 (change log)
DescriptionMedicago truncatula miR2604 stem-loop
Gene family MIPF0001276; MIR5267
Stem-loop
   -    g                 a                         a c       uagaguguauuuaaccacuguuuaguuauuuauuugcuaaaauacuccuucuaaaaaauaaguggguguauucuagcaaaugcc 
5'  guuu cuagaacacauccacua uuuuuaugugggaguguuuuagcaa g uauaacu                                                                                    u
    |||| ||||||||||||||||| ||||||||||||||||||||||||| | |||||||                                                                                    a
3'  uaaa gaucuugugugggugau aaaaauacacccucacaaaaucguu c auauuga                                                                                    u
   u    a                 c                         - a       uuuuuuaauuauuuauguggaauuccacauacaacgauauugugugaaagauuuuuuuguucacccacacaagaucguuuagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 5273845-5274131 [+]
intergenic
Database links

Mature sequence mtr-miR2604

Accession MIMAT0013308
Sequence

21 - 

uaauuuuuaugugggaguguu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).