Stem-loop sequence mtr-MIR2605

AccessionMI0011856 (change log)
DescriptionMedicago truncatula miR2605 stem-loop
Stem-loop
   -----------------------------agauguacacuuaaacuuaguuuauaugaccuacuuaaacuggguuuacaugagcuacuuaaacuaaguuuac     -   cu   a  g       a        cu        g    caug 
5'                                                                                                       augau cua  uaa cu aguuuaa uauguaca  uaaacuua uuua    a
                                                                                                         ||||| |||  ||| || ||||||| ||||||||  |||||||| ||||    c
3'                                                                                                       uacua gau  auu ga ucaaauu auacaugu  auuugaau aaau    c
   ccuccaguacauuugacucaaauucacauguaugaauuugauucaaauuuauccaguacauuuggcucaaauucacauguaaauuuucaaguuggaacaagu     a   ac   a  g       c        ac        a    ucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 31560873-31561155 [+]
intergenic
Database links

Mature sequence mtr-miR2605

Accession MIMAT0013309
Sequence

15 - 

acuuaguuuauaugaccuac

 - 34

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).