Stem-loop sequence mtr-MIR2607

AccessionMI0011860 (change log)
DescriptionMedicago truncatula miR2607 stem-loop
Stem-loop
   cacau     uaagg    uaa       -       u     gauuaagaugccuug 
5'      gcaua     aguc   gagcauu gucacau gucau               u
        |||||     ||||   ||||||| ||||||| |||||               u
3'      uguau     uuag   uuuguga uagugua uagug               g
   ----u     -ugua    uua       a       u     uauaaguuaguaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 3391869-3391981 [+]
intergenic
Database links

Mature sequence mtr-miR2607

Accession MIMAT0013313
Sequence

74 - 

augugauuaugugauaagugu

 - 94

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).