Stem-loop sequence mtr-MIR2608

AccessionMI0011861 (change log)
DescriptionMedicago truncatula miR2608 stem-loop
Stem-loop
   a      -    aaa      u         a    cua         -          cucucucagacucacauuaucuucuuauucccucucuuccuuuuucu 
5'  uugcaa agag   ugauau uguacaacu uuuu   acaacuuuu ugacaacuuu                                               c
    |||||| ||||   |||||| ||||||||| ||||   ||||||||| ||||||||||                                               u
3'  aacguu ucuc   acuaua acauguuga gaaa   uguugaaag acuguugaaa                                               c
   a      a    auc      u         -    cca         u          ccaaaagagagaaaacuaaccaguuuuuauuaucucucucucucucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 29324716-29324927 [+]
intergenic
Database links

Mature sequence mtr-miR2608

Accession MIMAT0013314
Sequence

183 - 

guuguacauauaucacuacucu

 - 204

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).