Stem-loop sequence mtr-MIR2609a

AccessionMI0011862 (change log)
DescriptionMedicago truncatula miR2609a stem-loop
Gene family MIPF0000864; MIR2609
Stem-loop
   ggcc       ---   u      g  -a     -ucu  c  g       aaaguuuagauguauggaaaucuucauuagauaaauaugaaagaguucuucacaaagagauucaugaaauucuuaaagu 
5'     uuccauu   ggc uuggaa ua  uaggu    ca uu uuuggca                                                                               u
       |||||||   ||| |||||| ||  |||||    || || |||||||                                                                                
3'     aagguaa   ucg gauuuu gu  aucca    gu aa aaaccgu                                                                               a
   acuu       aag   u      g  ac     uauc  u  g       aucgaguaaaguauucuuaacuucuuuguucgcuacaguucuuuuuaugggaagacuaguaguagguuuaguaguaucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 14996815-14997071 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2609a
mtr-MIR5242chr2: 14987203-14987268 [-]
mtr-MIR2609achr2: 14996815-14997071 [+]
Database links

Mature sequence mtr-miR2609a

Accession MIMAT0013315
Sequence

17 - 

uggaaguaauagguucucacu

 - 37

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).