Stem-loop sequence mtr-MIR2610b

AccessionMI0011866 (change log)
DescriptionMedicago truncatula miR2610b stem-loop
Gene family MIPF0000988; MIR2610
Literature search

1 open access papers mention mtr-MIR2610b
(1 sentences)

   aagauugagacuuguauggcuucguugaaggaugcccggagaguaauucaggaaggcaaaaccgaaggcuggggucagcuaguggaguugccagaaaacaagcguaaggagggaauugguuuccuugacaguaagccugggauguucgacccuac   -          ------     -u      u      augauucaccagagaccaaug 
5'                                                                                                                                                            cag agguucuuuc      cacag  gcuggu ucauuc                     c
                                                                                                                                                              ||| ||||||||||      |||||  |||||| ||||||                     a
3'                                                                                                                                                            guc uucgaggagg      guguu  uggcca agugag                     a
   ---------------uuguuucgggauguacuaaagugaaagcggaacccgucuugauuuccucaaaagaauuuuuguuuuuuguuguuuuuuguucuguuuguguaaugaaucucgucccacagugucuuccuuacaguugucguuaggucaac   g          uccgca     uc      c      gagguccacguaguagauuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 2035062-2035473 [+]
Clustered miRNAs
< 10kb from mtr-MIR2610b
mtr-MIR2615cchr7: 2027418-2027632 [+]
mtr-MIR2610bchr7: 2035062-2035473 [+]
Database links

Mature sequence mtr-miR2610b

Accession MIMAT0013319

2 - 


 - 22

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).