Stem-loop sequence mtr-MIR2611

AccessionMI0011867 (change log)
DescriptionMedicago truncatula miR2611 stem-loop
Stem-loop
   u   -uuu              u    -gaa  u    g u   u    gg    ca     agacuggaaagaaagaacaugcuaucuacuaucugagcaagaaguucaccgacugugaaacucgguauacaaugcuugagaagacuug 
5'  gau    guauuugucagugu ugau    uc gugg a gcg gcuu  ucaa  agaug                                                                                        u
    |||    |||||||||||||| ||||    || |||| | ||| ||||  ||||  |||||                                                                                         
3'  cug    cguagacggucgca guua    gg cauu u cgu cgaa  aguu  ucuau                                                                                        u
   u   uuuu              c    gaag  u    g -   -    ag    --     augaacuagccuagguaagaccuauaguugguucaacauacuaagugguuuauuacugcguccgcaaaccgucggguucgaucuggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 4044572-4044867 [+]
intergenic
Database links

Mature sequence mtr-miR2611

Accession MIMAT0013320
Sequence

9 - 

uauuugucaguguuugaugaa

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).