Stem-loop sequence mtr-MIR2585c

AccessionMI0011869 (change log)
DescriptionMedicago truncatula miR2585c stem-loop
Gene family MIPF0000820; MIR2585
Stem-loop
   u                            u           u    ac  g       auca                 a    u  ga  a         c         acuaauuugaugauguggcaaucacugccaaacaugaaauuccaauuuugcccuuaa 
5'  aggggucguuuaaaaauuggucccugua ucgcuaauccu gcaa  ua ccuugca    uuaaucauuuaaaauuu gucc uu  cc acuuaauca ugccacguc                                                         g
    |||||||||||||||||||||||||||| ||||||||||| ||||  || |||||||    ||||||||||||||||| |||| ||  || ||||||||| |||||||||                                                         a
3'  uccccagcaaauuuuuaaccagggacau agcgauuagga cguu  au gggacgu    aauuaguaaauuuuaaa cagg ag  gg ugaauuagu acggugcgg                                                         a
   -                            u           c    aa  g       aaca                 g    u  ag  g         a         uguacuuuaagguuaaaaugggguccuaaagguuaggaaaaaguuauaaaacaggag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 11514537-11514874 [-]
intergenic
Database links

Mature sequence mtr-miR2585c

Accession MIMAT0013322
Sequence

298 - 

caggauuagcgauuacagggac

 - 319

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).