Stem-loop sequence mtr-MIR2585d

AccessionMI0011870 (change log)
DescriptionMedicago truncatula miR2585d stem-loop
Gene family MIPF0000820; MIR2585
Stem-loop
   u                                         gu     gu         a                             a            cc  a                          a                      -      -a     agaagaugaagac 
5'  aggcgucauuuaaaaauuagucccuguaaucguuaauccug  aauuu  ccuugcauu uuuaaucauuuaaaauuucguccuuugac aacuuaaucacu  ca gucaucaaauuagcaaaauggcaugg aauggacaaaaauacccucguc uuuauu  ugaga             a
    |||||||||||||||||||||||||||||||||||||||||  |||||  ||||||||| ||||||||||||||||||||||||||||| ||||||||||||  || |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||  |||||             g
3'  uccgcaguaaauuuuuaaucagggacauuagcgauuaggac  uuaaa  ggaacguaa aaauuaguaaauuuuaaagcaggaaacug uugaauuaguga  gu caguaguuuaaucguuuuacuguacc uuaccuguuuuuaugggagcag agguaa  acuuu             g
   -                                         ug     ug         c                             g            ca  g                          c                      u      gc     acuguaaaaauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 19511859-19512226 [+]
intergenic
Database links

Mature sequence mtr-miR2585d

Accession MIMAT0013323
Sequence

328 - 

caggauuagcgauuacagggac

 - 349

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).