Stem-loop sequence mtr-MIR2612

AccessionMI0011872 (change log)
DescriptionMedicago truncatula miR2612 stem-loop
Stem-loop
   a    c   a                        g    g     c            uacacaa 
5'  uaag ucu ucauguauuugauagugucaacua uaca aaaac uaucuaucuagc       u
    |||| ||| |||||||||||||||||||||||| |||| ||||| ||||||||||||        
3'  guuc aga aguacauaaacuauuacaguugau augu uuuug auagauagauug       c
   a    a   a                        g    a     a            uauaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 24076464-24076595 [+]
intergenic
Database links

Mature sequence mtr-miR2612

Accession MIMAT0013325
Sequence

20 - 

ugauagugucaacuaguacag

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).