Stem-loop sequence mtr-MIR2613

AccessionMI0011874 (change log)
DescriptionMedicago truncatula miR2613 stem-loop
Stem-loop
   a    a   --gagaa  ag        g       g  g  ggugugaauacaguuaugaggagaaaaauggu 
5'  aucg ucu       ga  guugauug cggcggu gu gu                                u
    |||| |||       ||  |||||||| ||||||| || ||                                g
3'  uggc aga       cu  uaacuggu gccgcug ca cg                                u
   g    g   agaaagg  gg        g       g  g  acuagaggcaaguggugguaggaggcuauuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 9706906-9707054 [-]
intergenic
Database links

Mature sequence mtr-miR2613

Accession MIMAT0013327
Sequence

112 - 

cggucgccgguggucaauggu

 - 132

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).