Stem-loop sequence mtr-MIR2614

AccessionMI0011875 (change log)
DescriptionMedicago truncatula miR2614 stem-loop
Stem-loop
   --------------------------------------------uggaaaugaguggagucgaaccgaacc    u       gc    --cua  uaa   u 
5'                                                                        uguc gagcucg  ucga     ga   gaa u
                                                                          |||| |||||||  ||||     ||   |||  
3'                                                                        acag cuugagc  agcu     cu   cuu u
   acuuggauugcucagcuuggcuugauaagcacuugaaauuuguucagcuuaagcucgacuuuuuuucaagc    -       uc    caaaa  cgg   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 27920429-27920589 [-]
intergenic
Database links

Mature sequence mtr-miR2614

Accession MIMAT0013328
Sequence

141 - 

cgguucgacucguuagguuc

 - 160

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).