Stem-loop sequence mtr-MIR2615a

AccessionMI0011876 (change log)
DescriptionMedicago truncatula miR2615a stem-loop
Gene family MIPF0000898; MIR2615
Stem-loop
   cguuuaaaaccucuuguc   a         -  u   -- g   c       -u   u   u    c  uu    uu ---     uuuuuugucuuuagucauucaaaaaaguuuuuuuuacguuaaauc 
5'                   cgu uuuuaaaau ug uca  c uuc cuuuuuu  cgu guu uuac au  aaag  c   guguu                                             a
                     ||| ||||||||| || |||  | ||| |||||||  ||| ||| |||| ||  ||||  |   |||||                                             a
3'                   gcg aaaauuuua gc agu  g aag gaaaaaa  gca uag aaug ua  uuuu  g   cgcag                                             c
   --acuaauuauuuuuuuu   g         c  u   cc g   a       cu   c   c    c  uu    uu aua     cauuuuuacuuucacucugcaaaaauuugcagcacuuugcgcuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 3236093-3236350 [-]
intergenic
Database links

Mature sequence mtr-miR2615a

Accession MIMAT0013329
Sequence

221 - 

ccugaucgcauuuuaaaaggc

 - 241

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).