Stem-loop sequence mtr-MIR2615c

AccessionMI0011878 (change log)
DescriptionMedicago truncatula miR2615c stem-loop
Gene family MIPF0000898; MIR2615
Stem-loop
   --------------------------------ccguauuuuaaaaugguucacguucccuuuuauucguuuuuuu   ccauuu     u    --uuucu   --c     uc  uca      u 
5'                                                                            gua      aaagu uggg       ugu   uuuag  gu   aaaagu u
                                                                              |||      ||||| ||||       |||   |||||  ||   ||||||  
3'                                                                            cau      uuuca acuc       gca   aaauu  ca   uuuuua u
   ugcggaaaauuuuacgcuaguccggaagagaaaaaaacugcacuagcaaugcuaauuuuuuuuucugauacgcug   uuuuac     c    uacgcuu   acu     ua  ---      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 2027418-2027632 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2615c
mtr-MIR2615cchr7: 2027418-2027632 [+]
mtr-MIR2610bchr7: 2035062-2035473 [+]
Database links

Mature sequence mtr-miR2615c

Accession MIMAT0013331
Sequence

193 - 

ccugaucgcauuuuaaaaggc

 - 213

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).