Stem-loop sequence mtr-MIR2616

AccessionMI0011879 (change log)
DescriptionMedicago truncatula miR2616 stem-loop
Stem-loop
   u           u gu   g c     accacggguauggauuuuguugccaugccuaccuccaagcuacuaaagacaccuucagaagaaccuguuuaugccaacuaagaucucucguugcaucaacauccauauuuugaugcaauu 
5'  caaauuggguu g  ucg g ggaua                                                                                                                        g
    ||||||||||| |  ||| | |||||                                                                                                                         
3'  guuugacucaa c  agu c ccugu                                                                                                                        g
   u           u ug   g -     aauaauuuuuuuaauuguuaaaaccaauaaugauguuucgugucucaacauagcagaaaacauauauauuuuuuuuccuuuauuguauccuuaauuccuuguuuaaaucccuacaacgua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 5651277-5651571 [-]
intergenic
Database links

Mature sequence mtr-miR2616

Accession MIMAT0013332
Sequence

5 - 

auuggguuugguucgggcggau

 - 26

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).