Stem-loop sequence mtr-MIR1509b

AccessionMI0011880 (change log)
DescriptionMedicago truncatula miR1509b stem-loop
Gene family MIPF0000771; MIR1509
Literature search

2 open access papers mention mtr-MIR1509b
(4 sentences)

Stem-loop
   u       u  c   cu       u       u     c   u  ccau       g 
5'  ugaucca ug auu  uuuaauc aggaaau acacu gag ga    gagauga g
    ||||||| || |||  ||||||| ||||||| ||||| ||| ||    ||||||| a
3'  acuaggu ac uaa  aaauuag uccuuua uguga cuc cu    cucuauu u
   u       u  u   ag       u       -     u   u  cucu       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 22804649-22804764 [+]
intergenic
Database links

Mature sequence mtr-miR1509b

Accession MIMAT0013333
Sequence

19 - 

uuaaucuaggaaauuacacucg

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).