Stem-loop sequence mtr-MIR2617a

AccessionMI0011881 (change log)
DescriptionMedicago truncatula miR2617a stem-loop
Gene family MIPF0000907; MIR2617
Stem-loop
   au            g      uggguuga    u  ---u       uaa 
5'   guaguguagcau cccguu        acuc ga    guugaau   u
     |||||||||||| ||||||        |||| ||    |||||||    
3'   uaucacauugug gggcaa        uggg uu    uaauuua   u
   -g            -      --------    u  ucau       uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 35129122-35129210 [+]
intergenic
Database links

Mature sequence mtr-miR2617a

Accession MIMAT0013334
Sequence

2 - 

uguaguguagcaugcccguu

 - 21

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).