Stem-loop sequence mtr-MIR2617c

AccessionMI0011882 (change log)
DescriptionMedicago truncatula miR2617c stem-loop
Gene family MIPF0000907; MIR2617
Stem-loop
   c        aaauu   -aa  gu          g      - g    uuacuga         
5'  uauuuaag     uug   au  aguguagcau cccguu u ugaa       ugaauauu 
    ||||||||     |||   ||  |||||||||| |||||| | ||||       ||||||| u
3'  augaauuc     aac   ua  uuacauugug gggcaa g guuu       auuuauau 
   u        -----   agg  gu          -      u g    -ucauua         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 9118230-9118347 [+]
intergenic
Database links

Mature sequence mtr-miR2617c

Accession MIMAT0013335
Sequence

21 - 

uguaguguagcaugcccguu

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).