Stem-loop sequence mtr-MIR2617b

AccessionMI0011883 (change log)
DescriptionMedicago truncatula miR2617b stem-loop
Gene family MIPF0000907; MIR2617
Stem-loop
   a             g     uuggugaauuacucugaugaaua 
5'  uguaguguagcau cccgu                       u
    ||||||||||||| |||||                        
3'  auauuacauugug gggca                       u
   -             -     auggguuuucauuaauuuauauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 9343767-9343852 [-]
intergenic
Database links

Mature sequence mtr-miR2617b

Accession MIMAT0013336
Sequence

2 - 

uguaguguagcaugcccguu

 - 21

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).