Stem-loop sequence mtr-MIR2618a

AccessionMI0011884 (change log)
DescriptionMedicago truncatula miR2618a stem-loop
Gene family MIPF0001016; MIR2618
Stem-loop
   guagguuaauguaauuucaguuuacguauguucaauuuagguuaauguaaauucaguuuacuuauguauaugguguagguuaauguaaauucaguuuacguauauucaauuuaguuuaauguaaauucaauuuacg        a        -         ----ua         auguuu  aag       uaug    ua 
5'                                                                                                                                         uauguuaa uuuagguu aacguaaau      aguuuacgu      au   agguuag    aauu  g
                                                                                                                                           |||||||| |||||||| |||||||||      |||||||||      ||   |||||||    ||||   
3'                                                                                                                                         auguaauu gaauuuaa uuguauuua      uuaaaugua      ug   ucuaauu    uuga  u
   ---------------------------------------------------------------aauguaauuguauuuaacuugcaugcauuugacuuaagugugauuagagaauauauguaugcauuuuaauuaa        -        c         uuugac         ----au  -ga       ugua    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 2591225-2591564 [-]
intergenic
Database links

Mature sequence mtr-miR2618a

Accession MIMAT0013337
Sequence

301 - 

gugaauucaguuuacguacguu

 - 322

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).