Stem-loop sequence mtr-MIR2618b

AccessionMI0011885 (change log)
DescriptionMedicago truncatula miR2618b stem-loop
Gene family MIPF0001016; MIR2618
Stem-loop
   agcauguaccauguacgaauuuggguugcauucugacuagguaucucuuucaaauuauacguaaauauauuuaaaagagauacguauguauauaa   gu   u       u       uuaugu            -----aau        
5'                                                                                                gag  uag gugaauu aauuuac      uuaaucuagguu        guaaauu 
                                                                                                  |||  ||| ||||||| |||||||      ||||||||||||        |||||| u
3'                                                                                                cuu  auu cauuuaa uuaaaug      aauuagauuuaa        cauuuaa 
   -------auguaauuggaucuaacuugcaugcauuugacuuaagugugauuggagaauauauguauacaauugaauuaaauguaauugaauuuaa   gu   -       c       -----u            caaguauu        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 28342357-28342643 [-]
intergenic
Database links

Mature sequence mtr-miR2618b

Accession MIMAT0013338
Sequence

249 - 

gugaauucaguuuacguacguu

 - 270

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).