Stem-loop sequence mtr-MIR2619a

AccessionMI0011886 (change log)
Previous IDsmtr-MIR2619
DescriptionMedicago truncatula miR2619 stem-loop
Gene family MIPF0001294; MIR2619
Literature search

1 open access papers mention mtr-MIR2619a
(1 sentences)

Stem-loop
   agccc      u                 au c                   a       a  uc                                            auggucgaaacgug 
5'      ccuaac aauuaaaauacaaaaca  c ccuauguauuggaucuuug caguuuu gc  ccaagaccacuuuugauuuagucuuuguugacguggcacccaca              a
        |||||| |||||||||||||||||  | ||||||||||||||||||| ||||||| ||  ||||||||||||||||||||||||||||||||||||||||||||              u
3'      ggauug uuaauuuuauguuuugu  g ggauacauaaccuagaaac gucaaaa cg  gguuuuggugaaaacugaauuagaagcgacugcaccgugggugu              a
   cugua      u                 cg a                   c       c  ga                                            agggaauucgcucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 20630374-20630622 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2619a
mtr-MIR5281achr8: 20624516-20624683 [+]
mtr-MIR2619achr8: 20630374-20630622 [+]
Database links

Mature sequence mtr-miR2619a

Accession MIMAT0013339
Previous IDsmtr-miR2619
Sequence

210 - 

acauaggaggcuguuuuguau

 - 230

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).