Stem-loop sequence mtr-MIR2620

AccessionMI0011887 (change log)
DescriptionMedicago truncatula miR2620 stem-loop
Stem-loop
   -   ---u   c   -   uu   gg    u     gacuuu   cc      aaaguauuguggggaaugugaccgcauguaacagucugaguuuuagugaugaagac 
5'  uac    aga cag gcu  ugu  auua gaugu      ggg  aguuug                                                        c
    |||    ||| ||| |||  |||  |||| |||||      |||  ||||||                                                         
3'  aug    ucu guc cgg  aca  uagu uugua      ucc  ucagac                                                        u
   a   uaau   c   u   cc   ga    c     accuau   --      aagacguuucaugucucuacucauugcggacuaacacgaagaaggggaggcgaccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 13118436-13118648 [-]
intergenic
Database links

Mature sequence mtr-miR2620

Accession MIMAT0013340
Sequence

181 - 

uucugauagacaccggcucugc

 - 202

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).