Stem-loop sequence mtr-MIR2621

AccessionMI0011888 (change log)
DescriptionMedicago truncatula miR2621 stem-loop
Stem-loop
   gauccuaggagcuaaagugaagcuugggcuaggaauuugugcuaauuaaggcaaggggguuauucuuca         a      -        --uuu       a 
5'                                                                      ucauaauca uuaguu uuuaaguu     cuuaauu u
                                                                        ||||||||| |||||| ||||||||     |||||||  
3'                                                                      aguauuagu aguuaa aaguuuaa     gaauuag g
   -------------------guagguguuugaguagggauuuugaucucguucuuuaaguagaguguuua         -      u        uucgu       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 6977916-6978108 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2621
mtr-MIR2621chr6: 6977916-6978108 [-]
mtr-MIR2653achr6: 6968353-6968618 [-]
Database links

Mature sequence mtr-miR2621

Accession MIMAT0013341
Sequence

21 - 

agcuugggcuaggaauuugugc

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).