Stem-loop sequence mtr-MIR2622

AccessionMI0011889 (change log)
DescriptionMedicago truncatula miR2622 stem-loop
Stem-loop
   a     u   -cc   g       a  u  --g      --   gg 
5'  uuuug gug   auc ugaacuu au ua   uauuua  guc  u
    ||||| |||   ||| ||||||| || ||   ||||||  |||   
3'  aaaac cac   uag gcuugga ug au   auagau  cag  a
   a     -   cau   g       a  u  aua      aa   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 28572579-28572666 [-]
intergenic
Database links

Mature sequence mtr-miR2622

Accession MIMAT0013342
Sequence

3 - 

uuugugugccaucgugaacuua

 - 24

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).