Stem-loop sequence mtr-MIR2623

AccessionMI0011890 (change log)
DescriptionMedicago truncatula miR2623 stem-loop
Stem-loop
   a      aau     c   c        u    u  a       auuu  - cu       a 
5'  uuaaca   aaaua cuu ggcuguac gucc uc ugaacaa    gg c  ucuaaac a
    ||||||   ||||| ||| |||||||| |||| || |||||||    || |  ||||||| a
3'  aauugu   uuuau gaa ccgaugug cagg ag auuuguu    uc g  agauuug u
   g      -au     u   u        c    u  g       -guu  a au       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 31771069-31771192 [-]
intergenic
Database links

Mature sequence mtr-miR2623

Accession MIMAT0013343
Sequence

19 - 

ucggcuguacuguccuucaug

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).