Stem-loop sequence mtr-MIR2624

AccessionMI0011891 (change log)
DescriptionMedicago truncatula miR2624 stem-loop
Stem-loop
   uc  aa          cc     u    - ac 
5'   ga  gacgagguug  ggcug guga c  a
     ||  ||||||||||  ||||| |||| |   
3'   cu  uuguucuagc  uugac cacu g  a
   --  cc          uc     -    a cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 20017715-20017776 [+]
intergenic
Database links

Mature sequence mtr-miR2624

Accession MIMAT0013344
Sequence

2 - 

cgaaagacgagguugccggcu

 - 22

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).