Stem-loop sequence mtr-MIR2625

AccessionMI0011893 (change log)
DescriptionMedicago truncatula miR2625 stem-loop
Stem-loop
   ac              ac  uccaa     a      caccucauuaauccu      cagca      uuuucauaucguggcacguuccagacuuu 
5'   caucgugccacguu  ga     ucgug cacgau               acgugg     gacaaa                             a
     ||||||||||||||  ||     ||||| ||||||               ||||||     ||||||                              
3'   guagcacggugcaa  cu     agcac gugcua               ugcacc     cuguuu                             u
   --              au  uguag     c      ---------acaacu      -----      cuuaaacggugaccuuuaaaacacggugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 2760406-2760587 [+]
intergenic
Database links

Mature sequence mtr-miR2625

Accession MIMAT0013346
Sequence

2 - 

ccaucgugccacguuacgaucc

 - 23

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).