Stem-loop sequence mtr-MIR2626

AccessionMI0011894 (change log)
DescriptionMedicago truncatula miR2626 stem-loop
Stem-loop
   ---acuuauuauuaaauaaaaacaacgucgggauuuaggguguuauaaguuguguugaacuggguuaacaaacucuauguguuuuuuacuuuccugcc        uuuu   uu --u       ua 
5'                                                                                                   uuuuauuu    guu  g   uuaugcu  c
                                                                                                     ||||||||    |||  |   |||||||  u
3'                                                                                                   aagguaaa    caa  u   agugcga  g
   cugucuaguuccguuuauauugccuacaacuuaaaaucgcacaauuaaucuucaacaagauacacuacaaaguuaaagucuacgugucugucguauac        -uuu   gg ugu       uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 20180560-20180812 [+]
intergenic
Database links

Mature sequence mtr-miR2626

Accession MIMAT0013347
Sequence

21 - 

aacgucgggauuuaggguguu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).