Stem-loop sequence mtr-MIR2627

AccessionMI0011895 (change log)
DescriptionMedicago truncatula miR2627 stem-loop
Stem-loop
   c           u            -      caac   -------      u 
5'  cuucggcaguu gcuaccgaaguu uuuagg    cgg       cggcag u
    ||||||||||| |||||||||||| ||||||    |||       ||||||  
3'  ggagucgucaa ugauggcuuuaa aaauuc    guc       gccguc a
   a           u            c      --aa   uaaauga      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 5283120-5283217 [-]
intergenic
Database links

Mature sequence mtr-miR2627

Accession MIMAT0013348
Sequence

76 - 

uuucgguaguuaacugcugagg

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).