Stem-loop sequence mtr-MIR2592a

AccessionMI0011896 (change log)
DescriptionMedicago truncatula miR2592a stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592a
(2 sentences)

Stem-loop
   a                          u  g   c         c               -          gaa                g  c       aau      c  u  c   u   a  a 
5'  gauaaauucaaaccugccaaacaaca ga uca gcauuucgc cggcauucauguuuu ccuuugaaaa   uaaauuuuuguuaggu ug uuuagau   gguauu aa ug caa gaa ug g
    |||||||||||||||||||||||||| || ||| ||||||||| ||||||||||||||| ||||||||||   |||||||||||||||| || |||||||   |||||| || || ||| ||| || g
3'  cuauuuaaguuuggacgguuuguugu cu agu cguaaagcg gcuguaaguacaaaa ggaaacuuuu   auuuaagaacaaucca ac aaaucua   ccauaa uu ac guu cuu ac u
   -                          c  g   u         a               a          aug                -  c       cuu      -  c  a   c   -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 28276324-28276577 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592a
mtr-MIR2592achr1: 28276324-28276577 [+]
mtr-MIR2592abchr1: 28276328-28276573 [-]
Database links

Mature sequence mtr-miR2592a-5p

Accession MIMAT0020945
Previous IDsmtr-miR2592a*
Sequence

44 - 

cccggcauucauguuuuccu

 - 63

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR2592a-3p

Accession MIMAT0020946
Previous IDsmtr-miR2592a
Sequence

194 - 

gaaaaacaugaaugucgagcg

 - 214

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR2592a.2-3p

Accession MIMAT0013349
Previous IDsmtr-miR2592a;mtr-miR2592a.2
Sequence

215 - 

aaaugcuugaguccuguuguu

 - 235

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2