Stem-loop sequence mtr-MIR2592h

AccessionMI0011898 (change log)
DescriptionMedicago truncatula miR2592h stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592h
(2 sentences)

Stem-loop
   a     -uuc    u      a    caua                 a        a                 u      c   u  u   - g         a     -          -      a 
5'  gguaa    aaac ugccaa cggc    acucgagcauuucgucc gcguucau uuuuuccuuugaaaaga uaaauu uug ua gcu g uuuagauga gguau uaagugucaa ggaaug a
    |||||    |||| |||||| ||||    ||||||||||||||||| |||||||| ||||||||||||||||| |||||| ||| || ||| | ||||||||| ||||| |||||||||| |||||| c
3'  ccauu    uuug acgguu guug    ugaguucguaaagcagg cguaagua gaaaaggaaacuuuucu auuuaa aac au cga c aaaucuacu cuaua guucacgguu cuuugc c
   c     uaaa    u      -    -ucc                 g        c                 u      a   c  c   a g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 36122992-36123246 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592h
mtr-MIR2592aechr3: 36122943-36123293 [-]
mtr-MIR2592hchr3: 36122992-36123246 [+]
Database links

Mature sequence mtr-miR2592h

Accession MIMAT0013351
Sequence

216 - 

aaaugcuugaguccuguuguu

 - 236

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).