Stem-loop sequence mtr-MIR2592k

AccessionMI0011899 (change log)
DescriptionMedicago truncatula miR2592k stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592k
(2 sentences)

Stem-loop
   g  a          c  ca                a        c  a            uc            a           gag   u c         u      c     ccaccgaa ug   uu 
5'  ag uaauucaaac ug  aaacaacaggacucaa cauuucgc aa caccucauguuu  ccuuugaaaaua uaaauuuuugu   gcu g uuuagauga gguauu aagug        u  agg  c
    || |||||||||| ||  |||||||||||||||| |||||||| || ||||||||||||  |||||||||||| |||||||||||   ||| | ||||||||| |||||| |||||        |  |||   
3'  uc auuaaguuug ac  uuuguuguccugaguu guaaagcg uu guggaguacaaa  ggaaacuuuuau auuuaaaaaca   cga c aaaucuacu ccauaa uucac        a  ucc  a
   -  c          a  ag                c        -  c            ga            a           aua   c -         u      -     -------- gu   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 16339495-16339750 [-]
intergenic
Database links

Mature sequence mtr-miR2592k

Accession MIMAT0013352
Sequence

217 - 

aaaugcuugaguccuguuguu

 - 237

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).