Stem-loop sequence mtr-MIR2592l

AccessionMI0011900 (change log)
DescriptionMedicago truncatula miR2592l stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592l
(2 sentences)

Stem-loop
   g     -u                  cau                  aa                         u      c      u   - g        aa     -          -      a 
5'  gguaa  ucaaacuugccaaacgac   gacucaagcauuuugccc  cguucauguuuuuccuuugaaaaga uaaauu uuguua gcu g uuuagaug  gguau uaagugucaa ggaaug a
    |||||  ||||||||||||||||||   ||||||||||||||||||  ||||||||||||||||||||||||| |||||| |||||| ||| | ||||||||  ||||| |||||||||| |||||| c
3'  ccauu  aguuugaacgguuuguug   cugaguucguaaagcggg  guaaguacaaaaaggaaacuuuucu auuuaa aacaau uga c aaaucuac  ccaua guucacgguu cuuuac a
   -     uc                  -uc                  gc                         u      -      c   a g        ca     a          a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 38243118-38243371 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2592l
mtr-MIR2592amchr4: 38273117-38273362 [+]
mtr-MIR2592amchr4: 38243122-38243367 [+]
mtr-MIR2592lchr4: 38243118-38243371 [-]
Database links

Mature sequence mtr-miR2592l

Accession MIMAT0013353
Sequence

215 - 

aaaugcuugaguccuguuguu

 - 235

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).