Stem-loop sequence mtr-MIR2592n

AccessionMI0011902 (change log)
DescriptionMedicago truncatula miR2592n stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592n
(2 sentences)

Stem-loop
   g     -           c       cau                  a                   a      u   auucuug   u   - g         a     -     g    -      a 
5'  gguaa uucaaacuugc aagcggc   gacucaagcauuucgccc gcauucauguuuuuccuuu aaaaga uaa       uua gcu g uuuagauga gguau uaagu ccaa agaaug a
    ||||| ||||||||||| |||||||   |||||||||||||||||| ||||||||||||||||||| |||||| |||       ||| ||| | ||||||||| ||||| ||||| |||| |||||| c
3'  ccauu aaguuugaacg uuuguug   cugaguucguaaaguggg cguaaguauaaaaaggaaa uuuucu auu       aau cga c aaaucuacu cuaua guuca gguu uuuuac c
   -     u           u       -uc                  g                   c      u   gaaaaaa   c   a g         a     a     a    g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 42952619-42952873 [-]
intergenic
Database links

Mature sequence mtr-miR2592n

Accession MIMAT0013355
Sequence

216 - 

aaaugcuugaguccuguuguu

 - 236

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).