Stem-loop sequence mtr-MIR2111b

AccessionMI0011905 (change log)
DescriptionMedicago truncatula miR2111b stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111b
(8 sentences)

Stem-loop
   a      -   -uu  u              c ug         acaacaaau 
5'  uauugg gau   ga gggauaaucugcau c  agguuuaga         g
    |||||| |||   || |||||||||||||| |  |||||||||          
3'  guaacc cua   cu cucuauuagacgua g  uccgaaucu         c
   c      a   uuc  u              a gu         auauuaaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2111b

Accession MIMAT0013358
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).